ID: 1146409140_1146409147

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1146409140 1146409147
Species Human (GRCh38) Human (GRCh38)
Location 17:32566984-32567006 17:32567025-32567047
Sequence CCGTGCTCCATCCATGTTCACAG GGAGCAGATGATGCGGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 268} {0: 1, 1: 0, 2: 2, 3: 33, 4: 321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!