ID: 1146462626_1146462631

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1146462626 1146462631
Species Human (GRCh38) Human (GRCh38)
Location 17:33058212-33058234 17:33058263-33058285
Sequence CCTGGGAGGTAGGTAAGGCAGGC ACAGACCTGAAGTTGGAACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 283} {0: 1, 1: 0, 2: 1, 3: 26, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!