ID: 1146479438_1146479441

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1146479438 1146479441
Species Human (GRCh38) Human (GRCh38)
Location 17:33193165-33193187 17:33193214-33193236
Sequence CCTACTTAACTCAACTTAGAAGC GAAGTGATACAACTTTCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 89} {0: 1, 1: 0, 2: 1, 3: 24, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!