ID: 1146509072_1146509081

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1146509072 1146509081
Species Human (GRCh38) Human (GRCh38)
Location 17:33430226-33430248 17:33430272-33430294
Sequence CCTTCTCTTATGAACTGCATCCA GGTTTTATGGGACCAGGAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 146} {0: 1, 1: 0, 2: 7, 3: 14, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!