ID: 1146530947_1146530952

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1146530947 1146530952
Species Human (GRCh38) Human (GRCh38)
Location 17:33607318-33607340 17:33607347-33607369
Sequence CCCTGAGGGTGTAAGGCAGGGAG CACATTAGGGACCACCTACTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 330} {0: 1, 1: 0, 2: 0, 3: 5, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!