ID: 1146549782_1146549792

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1146549782 1146549792
Species Human (GRCh38) Human (GRCh38)
Location 17:33770306-33770328 17:33770356-33770378
Sequence CCCTGACCCCTAGTGTCTTCCTC TTGGTGTAAACATTTAATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 254} {0: 1, 1: 0, 2: 0, 3: 16, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!