ID: 1146579773_1146579781

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1146579773 1146579781
Species Human (GRCh38) Human (GRCh38)
Location 17:34026665-34026687 17:34026695-34026717
Sequence CCTCCAGCCATTTCCCAGCATTC CCCCAAATGCCAAAGGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 301} {0: 1, 1: 0, 2: 0, 3: 27, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!