ID: 1146705188_1146705199

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1146705188 1146705199
Species Human (GRCh38) Human (GRCh38)
Location 17:34996068-34996090 17:34996102-34996124
Sequence CCCACTTTAAGGACTACATTCCC TGGGGGCCACAGCATGATCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 121} {0: 1, 1: 0, 2: 2, 3: 25, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!