|
Left Crispr |
Right Crispr |
Crispr ID |
1146711740 |
1146711745 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:35047993-35048015
|
17:35048008-35048030
|
Sequence |
CCATTCACCTTGGCCTTCCACAG |
TTCCACAGTGCTGGGATTATAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 4, 2: 292, 3: 4332, 4: 35068} |
{0: 12, 1: 1582, 2: 43288, 3: 340827, 4: 246976} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|