ID: 1146711740_1146711745

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1146711740 1146711745
Species Human (GRCh38) Human (GRCh38)
Location 17:35047993-35048015 17:35048008-35048030
Sequence CCATTCACCTTGGCCTTCCACAG TTCCACAGTGCTGGGATTATAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 292, 3: 4332, 4: 35068} {0: 12, 1: 1582, 2: 43288, 3: 340827, 4: 246976}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!