ID: 1146716849_1146716856

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1146716849 1146716856
Species Human (GRCh38) Human (GRCh38)
Location 17:35093506-35093528 17:35093548-35093570
Sequence CCGTACAGCTCCAGGGCATGAGG ATCATTCATGGCAAATGTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 185} {0: 1, 1: 0, 2: 0, 3: 19, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!