ID: 1146731092_1146731100

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1146731092 1146731100
Species Human (GRCh38) Human (GRCh38)
Location 17:35194347-35194369 17:35194370-35194392
Sequence CCTGGGCCCCTCAGAGCTCCAGC CATTGTGACCTCATTGGAGTGGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 5, 3: 52, 4: 524} {0: 1, 1: 1, 2: 1, 3: 11, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!