ID: 1146775406_1146775411

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1146775406 1146775411
Species Human (GRCh38) Human (GRCh38)
Location 17:35610113-35610135 17:35610147-35610169
Sequence CCCCTAAGTAACACCATATGGTA TTTTTTATTTTTTTTTGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 133} {0: 230, 1: 86262, 2: 70255, 3: 104627, 4: 368091}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!