ID: 1146854205_1146854210

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1146854205 1146854210
Species Human (GRCh38) Human (GRCh38)
Location 17:36249993-36250015 17:36250026-36250048
Sequence CCTGCACACTCCTCTTAGGAGAG GGAGAAATTGCAGTTCAGGAAGG
Strand - +
Off-target summary {0: 6, 1: 2, 2: 2, 3: 9, 4: 130} {0: 8, 1: 1, 2: 5, 3: 23, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!