ID: 1146854939_1146854955

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1146854939 1146854955
Species Human (GRCh38) Human (GRCh38)
Location 17:36254318-36254340 17:36254367-36254389
Sequence CCCACAGGGTAGGTGTCTTCCCG AAGAACGAGGTGCCCGTGGCGGG
Strand - +
Off-target summary {0: 14, 1: 1, 2: 0, 3: 6, 4: 91} {0: 14, 1: 0, 2: 1, 3: 13, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!