ID: 1146870804_1146870812

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1146870804 1146870812
Species Human (GRCh38) Human (GRCh38)
Location 17:36378092-36378114 17:36378108-36378130
Sequence CCAAGGGCCCTCTACGTCCAGGT TCCAGGTCCGTTGGGAGGCGGGG
Strand - +
Off-target summary {0: 11, 1: 1, 2: 3, 3: 10, 4: 108} {0: 12, 1: 3, 2: 0, 3: 5, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!