ID: 1146960651_1146960656

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1146960651 1146960656
Species Human (GRCh38) Human (GRCh38)
Location 17:36973758-36973780 17:36973778-36973800
Sequence CCTTATATAAAATTTAGAAAATA ATAGCCAAGCAGGCTGGGGACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 24, 3: 195, 4: 1924} {0: 1, 1: 0, 2: 3, 3: 45, 4: 449}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!