ID: 1147012724_1147012734

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1147012724 1147012734
Species Human (GRCh38) Human (GRCh38)
Location 17:37464507-37464529 17:37464547-37464569
Sequence CCATTACTGCCAGCAGTTCCTGC GACAGTGAGGTGGCCGGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 188} {0: 1, 1: 3, 2: 13, 3: 96, 4: 753}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!