ID: 1147026306_1147026311

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1147026306 1147026311
Species Human (GRCh38) Human (GRCh38)
Location 17:37587684-37587706 17:37587704-37587726
Sequence CCCCCAAACTGCTCTTGGTAACG ACGTCAACAATCACCCACATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 139} {0: 1, 1: 0, 2: 0, 3: 0, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!