ID: 1147068130_1147068138

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1147068130 1147068138
Species Human (GRCh38) Human (GRCh38)
Location 17:37933031-37933053 17:37933072-37933094
Sequence CCCCGACTGGCCCGAGGGCAGCT GATCCTCTGTTCTGGCCCAGAGG
Strand - +
Off-target summary {0: 14, 1: 2, 2: 2, 3: 9, 4: 119} {0: 14, 1: 5, 2: 2, 3: 15, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!