ID: 1147068132_1147068138

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1147068132 1147068138
Species Human (GRCh38) Human (GRCh38)
Location 17:37933033-37933055 17:37933072-37933094
Sequence CCGACTGGCCCGAGGGCAGCTTC GATCCTCTGTTCTGGCCCAGAGG
Strand - +
Off-target summary {0: 14, 1: 4, 2: 3, 3: 12, 4: 122} {0: 14, 1: 5, 2: 2, 3: 15, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!