ID: 1147078346_1147078362

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1147078346 1147078362
Species Human (GRCh38) Human (GRCh38)
Location 17:38006705-38006727 17:38006747-38006769
Sequence CCCCTGGTGCAGCCAGAGTACAC GCTCCCTTGACCCTGGCGGGGGG
Strand - +
Off-target summary {0: 11, 1: 4, 2: 3, 3: 11, 4: 147} {0: 11, 1: 0, 2: 3, 3: 24, 4: 425}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!