ID: 1147080096_1147080108

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1147080096 1147080108
Species Human (GRCh38) Human (GRCh38)
Location 17:38014290-38014312 17:38014325-38014347
Sequence CCTGCAGTGGAACTCCATGCCCC ACCTGGACGTAGAGGGCCCTTGG
Strand - +
Off-target summary {0: 14, 1: 0, 2: 6, 3: 15, 4: 156} {0: 11, 1: 1, 2: 3, 3: 10, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!