ID: 1147084511_1147084516

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1147084511 1147084516
Species Human (GRCh38) Human (GRCh38)
Location 17:38054047-38054069 17:38054080-38054102
Sequence CCTGCACACTCCTCTTAGGAGAG GGAGAAATTGCAGTTCAGGAAGG
Strand - +
Off-target summary {0: 6, 1: 2, 2: 2, 3: 9, 4: 130} {0: 8, 1: 1, 2: 5, 3: 23, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!