ID: 1147085209_1147085221

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1147085209 1147085221
Species Human (GRCh38) Human (GRCh38)
Location 17:38058254-38058276 17:38058289-38058311
Sequence CCAAGGGCCCTCTACGTCCAGGT GGGGCATGGAGTTCCACTGCAGG
Strand - +
Off-target summary {0: 11, 1: 1, 2: 3, 3: 10, 4: 108} {0: 14, 1: 0, 2: 6, 3: 15, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!