ID: 1147117785_1147117788

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1147117785 1147117788
Species Human (GRCh38) Human (GRCh38)
Location 17:38314955-38314977 17:38314989-38315011
Sequence CCCACTTCATTATGTCTCTCCTG CAGATTACAGTTTTATACCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 387} {0: 1, 1: 0, 2: 0, 3: 17, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!