ID: 1147139518_1147139532

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1147139518 1147139532
Species Human (GRCh38) Human (GRCh38)
Location 17:38453582-38453604 17:38453626-38453648
Sequence CCTGGCGTGTGGGGTGTGAGTGT AGGGGCCGCCCCGGAGGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 1089, 4: 1792} {0: 1, 1: 0, 2: 5, 3: 37, 4: 517}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!