ID: 1147145037_1147145054

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1147145037 1147145054
Species Human (GRCh38) Human (GRCh38)
Location 17:38479736-38479758 17:38479785-38479807
Sequence CCCTTTTTCCTACACAGCCATAG CCAAAGGCTCTCGCGGCCTGGGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 2, 3: 17, 4: 200} {0: 5, 1: 0, 2: 2, 3: 3, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!