ID: 1147149724_1147149729

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1147149724 1147149729
Species Human (GRCh38) Human (GRCh38)
Location 17:38507715-38507737 17:38507740-38507762
Sequence CCACATTGCACAACTCCAGGGGG CCTTCTGGTGTTGTGCATTGTGG
Strand - +
Off-target summary {0: 4, 1: 10, 2: 25, 3: 68, 4: 197} {0: 1, 1: 0, 2: 0, 3: 23, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!