ID: 1147153312_1147153325

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1147153312 1147153325
Species Human (GRCh38) Human (GRCh38)
Location 17:38530978-38531000 17:38531030-38531052
Sequence CCCATAAATGTGCAGGAACCAAA TTCACCCGAGCGGGTGGGGCGGG
Strand - +
Off-target summary {0: 5, 1: 0, 2: 0, 3: 8, 4: 182} {0: 1, 1: 1, 2: 4, 3: 12, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!