ID: 1147153314_1147153323

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1147153314 1147153323
Species Human (GRCh38) Human (GRCh38)
Location 17:38530996-38531018 17:38531026-38531048
Sequence CCAAAGAGAAAGAAAGATGCAAA GGGCTTCACCCGAGCGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 5, 3: 111, 4: 1003} {0: 1, 1: 1, 2: 9, 3: 10, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!