ID: 1147161016_1147161027

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1147161016 1147161027
Species Human (GRCh38) Human (GRCh38)
Location 17:38569446-38569468 17:38569481-38569503
Sequence CCATGCCAGGGTGTCCTGGGCCA CCTGGCAGGGAGGAGTTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 320} {0: 1, 1: 0, 2: 4, 3: 66, 4: 632}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!