ID: 1147166567_1147166575

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1147166567 1147166575
Species Human (GRCh38) Human (GRCh38)
Location 17:38596564-38596586 17:38596589-38596611
Sequence CCGCCTGCCTCCTTCATGCCAGG ATGCCATTCTGGAAGGTTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 75, 4: 562} {0: 1, 1: 0, 2: 2, 3: 21, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!