ID: 1147212427_1147212444

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1147212427 1147212444
Species Human (GRCh38) Human (GRCh38)
Location 17:38879686-38879708 17:38879738-38879760
Sequence CCTTACCCCAAACCTTCCTTGCT ACCACTCTTTCATCTTTTTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 355} {0: 1, 1: 0, 2: 2, 3: 23, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!