ID: 1147250391_1147250405

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1147250391 1147250405
Species Human (GRCh38) Human (GRCh38)
Location 17:39149750-39149772 17:39149783-39149805
Sequence CCTCCCAATTCCCCCTTCCCCAG GGTTCACACAATCCAGCCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 95, 4: 1046} {0: 1, 1: 0, 2: 0, 3: 4, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!