ID: 1147292014_1147292017

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1147292014 1147292017
Species Human (GRCh38) Human (GRCh38)
Location 17:39451148-39451170 17:39451164-39451186
Sequence CCGGGACGCAGGGCACCAGCAGT CAGCAGTCCCTACTCTTCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 144} {0: 1, 1: 0, 2: 2, 3: 23, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!