ID: 1147293410_1147293418

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1147293410 1147293418
Species Human (GRCh38) Human (GRCh38)
Location 17:39461761-39461783 17:39461774-39461796
Sequence CCCGGCGCCCGGGCCTGAGGACT CCTGAGGACTGGCTCGGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 178} {0: 1, 1: 0, 2: 0, 3: 16, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!