ID: 1147312561_1147312576

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1147312561 1147312576
Species Human (GRCh38) Human (GRCh38)
Location 17:39604160-39604182 17:39604185-39604207
Sequence CCCCCAGGTCTCCATCCCCACCC CACCCCAGGAGGGGACAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 94, 4: 751} {0: 1, 1: 0, 2: 5, 3: 44, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!