ID: 1147387387_1147387396

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1147387387 1147387396
Species Human (GRCh38) Human (GRCh38)
Location 17:40090442-40090464 17:40090471-40090493
Sequence CCATCCACCTCCTCCTTCCACAC ACCCACCCAGGAAAAAACTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 217, 4: 2296} {0: 1, 1: 0, 2: 1, 3: 19, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!