ID: 1147403618_1147403621

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1147403618 1147403621
Species Human (GRCh38) Human (GRCh38)
Location 17:40195350-40195372 17:40195373-40195395
Sequence CCTCCCTGCTACTGCTGATGCAC TCTCCTCTCCCTGCAGCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 234} {0: 1, 1: 7, 2: 31, 3: 241, 4: 1407}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!