ID: 1147418953_1147418963

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1147418953 1147418963
Species Human (GRCh38) Human (GRCh38)
Location 17:40312509-40312531 17:40312537-40312559
Sequence CCCCTGGCAGGAGGGACGTGCAG CACGGGGCAGGCAGAGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 189} {0: 1, 1: 0, 2: 9, 3: 93, 4: 789}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!