ID: 1147486430_1147486443

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1147486430 1147486443
Species Human (GRCh38) Human (GRCh38)
Location 17:40819141-40819163 17:40819191-40819213
Sequence CCGCGTCCGCCGCCTCCGGAACT CTCTAACGTTGGAAAACGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 99} {0: 1, 1: 0, 2: 0, 3: 2, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!