ID: 1147505715_1147505720

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1147505715 1147505720
Species Human (GRCh38) Human (GRCh38)
Location 17:41015319-41015341 17:41015356-41015378
Sequence CCTCAATAAATGATTCTAATAGG CTAAATAAGCAGAGGGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 168} {0: 1, 1: 0, 2: 5, 3: 23, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!