ID: 1147529961_1147529967

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1147529961 1147529967
Species Human (GRCh38) Human (GRCh38)
Location 17:41266277-41266299 17:41266310-41266332
Sequence CCAATTTTTTTTATTTCTTTGCC CTTGGGAATCAGCTTGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 32, 3: 329, 4: 3453} {0: 1, 1: 3, 2: 5, 3: 23, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!