ID: 1147550682_1147550695

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1147550682 1147550695
Species Human (GRCh38) Human (GRCh38)
Location 17:41439308-41439330 17:41439360-41439382
Sequence CCCACACTTGTCTGCCTCCACCA CTTTCATCACAGGAGGTACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 260} {0: 1, 1: 0, 2: 1, 3: 14, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!