ID: 1147612857_1147612879

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1147612857 1147612879
Species Human (GRCh38) Human (GRCh38)
Location 17:41811937-41811959 17:41811987-41812009
Sequence CCGGAGCTGAGCTGGCTGCCCCG CGGGCGGGCGGCGCGCCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 374} {0: 1, 1: 0, 2: 8, 3: 48, 4: 425}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!