|
Left Crispr |
Right Crispr |
Crispr ID |
1147623167 |
1147623171 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:41881710-41881732
|
17:41881737-41881759
|
Sequence |
CCTCAGCCTCCCGAGTAGCTGGC |
TATGCCCCTGCCACCACGTCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 677, 1: 105064, 2: 291600, 3: 225942, 4: 124342} |
{0: 1, 1: 0, 2: 24, 3: 979, 4: 12077} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|