ID: 1147626037_1147626038

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1147626037 1147626038
Species Human (GRCh38) Human (GRCh38)
Location 17:41900756-41900778 17:41900777-41900799
Sequence CCTCTGCTTGAACACTTCTTGTG TGCCTGCTGTCTCACAGTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 252} {0: 1, 1: 0, 2: 3, 3: 18, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!