ID: 1147628071_1147628073

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1147628071 1147628073
Species Human (GRCh38) Human (GRCh38)
Location 17:41912734-41912756 17:41912750-41912772
Sequence CCAGGTATCTAGAGGCATTTGTG ATTTGTGCCCAGATGGAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 102} {0: 1, 1: 0, 2: 1, 3: 13, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!