ID: 1147678035_1147678044

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1147678035 1147678044
Species Human (GRCh38) Human (GRCh38)
Location 17:42220652-42220674 17:42220688-42220710
Sequence CCAGGGCCACTGGGGATGCAGAG CTCAGGAAAGGGAGGCCGAAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 54, 4: 443} {0: 2, 1: 0, 2: 3, 3: 36, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!