ID: 1147754802_1147754813

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1147754802 1147754813
Species Human (GRCh38) Human (GRCh38)
Location 17:42761234-42761256 17:42761271-42761293
Sequence CCGCCGCTCCTCGCCTCCTTGCT CTCCGGGTGGAGCGCGCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 79, 4: 961} {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!